RavenSeaidn
Answered

IDNStudy.com, ang iyong destinasyon para sa mga sagot ng eksperto. Tuklasin ang malalim na sagot sa iyong mga tanong mula sa aming komunidad ng mga bihasang propesyonal.

The sequence of DNA is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What is the sequence of the complimentary RNA strand?

(Pa help po, ty in advance)​

The Sequence Of DNA Is 5 ATGCATAGATTAGGATATCCCAGATAG 3 What Is The Sequence Of The Complimentary RNA StrandPa Help Po Ty In Advance class=

Sagot :

Yaaniiidn

Answer:

5′ ATGGTTCCATC 3′

3′ TACCAAGGTAG 5′ is it's complementary DANA strand. But for mRNA transcription from DNA only the strand with polarity from 3′→5′ act as a template & is referred to as template strand, thus the mRNA strand will be :

5′ AUGGUUCCAUC 3′ in mRNA thymine nucleaotide isn't existing rather uracil replaces it & binds with Adenine just lyk thymine.

P.S. when 5′-> 3′ DNA sequence is given, RNA has same sequence of nucleaotide as given DNA except uracil in place of thymine.

Explanation:

According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.

Maraming salamat sa iyong pakikilahok. Patuloy na magbahagi ng iyong mga ideya at kasagutan. Ang iyong kaalaman ay mahalaga sa ating komunidad. May mga katanungan ka? Ang IDNStudy.com ang may sagot. Salamat sa iyong pagbisita at sa muling pagkikita.