RavenSeaidn
Answered

IDNStudy.com, ang iyong mapagkukunan para sa mga sagot ng eksperto. Hanapin ang impormasyon na kailangan mo nang mabilis at madali sa pamamagitan ng aming komprehensibo at eksaktong platform ng tanong at sagot.

The sequence of DNA is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What is the sequence of the complimentary RNA strand?

(Pa help po, ty in advance)​

The Sequence Of DNA Is 5 ATGCATAGATTAGGATATCCCAGATAG 3 What Is The Sequence Of The Complimentary RNA StrandPa Help Po Ty In Advance class=

Sagot :

Yaaniiidn

Answer:

5′ ATGGTTCCATC 3′

3′ TACCAAGGTAG 5′ is it's complementary DANA strand. But for mRNA transcription from DNA only the strand with polarity from 3′→5′ act as a template & is referred to as template strand, thus the mRNA strand will be :

5′ AUGGUUCCAUC 3′ in mRNA thymine nucleaotide isn't existing rather uracil replaces it & binds with Adenine just lyk thymine.

P.S. when 5′-> 3′ DNA sequence is given, RNA has same sequence of nucleaotide as given DNA except uracil in place of thymine.

Explanation:

According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.

Maraming salamat sa iyong aktibong pakikilahok. Magpatuloy sa pagtatanong at pagbabahagi ng iyong mga ideya. Ang iyong kaalaman ay mahalaga sa ating komunidad. Sa IDNStudy.com, kami ay nangako na magbigay ng pinakamahusay na mga sagot. Salamat at sa muling pagkikita.